<aside> ⚠️
Unlisted alternate version. This is a second, materially different dsRNA synthesis protocol that sits in the repo at RNAi_dsRNA_Synthesis/RNAi_dsRNA_Synthesis/RNAidsRNASynthesis.md — a nested folder inside the main protocol's folder. It was never added to the index, so it has never been visible on the lab docs site.
It disagrees with the current protocol on the T7 overhang sequence. This version specifies 5′ TAATACGACTCACTATAGGG 3′, while dsRNA Synthesis specifies 5′ TAATACGACTCACTATAGGGAGA 3′ — three extra bases. Someone should decide which is correct and retire the other. Preserved here rather than dropped, but do not follow it without checking first.
</aside>
dsRNA generation for RNAi experiments.
An amplicon of 400–600 base pairs in length will need to be selected for the gene of interest prior to starting this protocol. Using Primer3, select primers and add T7 overhangs (5′ TAATACGACTCACTATAGGG 3′). These primers will need to be validated before starting, using cDNA of the life stage and species of interest.
| Component | Volume |
|---|---|
| Nuclease-free H₂O | 16.25 μL |
| Colorless GoTaq Buffer | 5 μL |
| 10 mM dNTPs | 0.5 μL |
| GoTaq Polymerase | 0.25 μL |
| 1:100 plasmid dilution | 1 μL |
| Forward primer (GSP+T7) | 1 μL |
| Reverse primer (GSP+T7) | 1 μL |
| Total | 25 μL |
The above master mix is for a single T7 reaction. Scale as needed.
<aside> 📝
The remainder of this alternate version follows the same broad sequence as the current protocol — thermal cycling, MinElute purification, T7 in vitro transcription, nuclease digestion, and dsRNA purification — with differing details throughout. Compare against dsRNA Synthesis before using anything from this page, and see the original file in the repo for the full text.
</aside>