<aside> 🧬

This protocol assumes you have already cloned a ~400–600 base pair fragment of your gene target into pGEM-T. Use Primer3 to select primers for initial cloning efforts, and BLAST to check for potential off-target effects. Add T7 overhangs to working primers: 5′ TAATACGACTCACTATAGGGAGA 3′.

</aside>

Materials

Adding T7 sites and scaling up the T7 template

  1. Assemble master mix according to the table below. This represents a single T7 reaction — scale as needed. GSP = gene-specific primer.
Component Volume
Nuclease-free H₂O 16.25 μL
Colorless GoTaq Buffer 5 μL
10 mM dNTPs 0.5 μL
GoTaq Polymerase 0.25 μL
1:100 plasmid dilution 1 μL
Forward primer (GSP+T7) 1 μL
Reverse primer (GSP+T7) 1 μL
Total 25 μL
  1. Run with the following thermocycler parameters:
Step Time Temperature Cycles
Initial denaturation 2 min 95°C 1
Denature / anneal / extend 30 s / 30 s / 1 min 95°C / Tm (GSP) / 72°C 5
Denature / anneal / extend 30 s / 30 s / 1 min 95°C / Tm (GSP+T7 −5°C) / 72°C 30
Final extension 5 min 72°C 1
Hold — 6°C 1
  1. Pool PCR products for each target. Run 5 μL of product on an agarose gel to verify that the PCR worked.

Purification and concentration of DNA

Concentrate the DNA using the Qiagen MinElute PCR Purification Kit.

  1. Add 5 volumes of Buffer PB to 1 volume of the pooled PCR reaction and mix.
  2. If the total PCR reaction plus buffer exceeds 750 μL, split the mixture and run it through the column in succession, discarding the flow-through after each 750 μL sample. Maximum of four 750 μL samples per column.
  3. Add 750 μL Buffer PE to the MinElute columns and centrifuge for 1 minute. Discard flow-through.
  4. Centrifuge the column for two minutes.
  5. Place each MinElute column in a clean 1.5 mL microcentrifuge tube.
  6. Add 10 μL of sterile water to the centre of the MinElute column. Let it stand for 1 minute, then centrifuge for one minute.
  7. Measure DNA concentration using the NanoDrop.

T7 in vitro transcription (IVT)